ID: 1014197495_1014197503

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1014197495 1014197503
Species Human (GRCh38) Human (GRCh38)
Location 6:118576631-118576653 6:118576668-118576690
Sequence CCTGTGTCTTGCATATGGGGGGA AGTTAGGCAATTGGGGGTTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 25, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!