ID: 1014205858_1014205868

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1014205858 1014205868
Species Human (GRCh38) Human (GRCh38)
Location 6:118654731-118654753 6:118654773-118654795
Sequence CCTCAATTCCCTTACCTGTAAAT TGCCTCACAGGATTGCTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 24, 3: 363, 4: 2362} {0: 2, 1: 7, 2: 73, 3: 405, 4: 1466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!