ID: 1014233979_1014233987

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1014233979 1014233987
Species Human (GRCh38) Human (GRCh38)
Location 6:118935031-118935053 6:118935059-118935081
Sequence CCACCGGCCGCGGGGACGCGCGG GTCGGGCGGCCTAGCGCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 206} {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!