ID: 1014299023_1014299024

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1014299023 1014299024
Species Human (GRCh38) Human (GRCh38)
Location 6:119657230-119657252 6:119657265-119657287
Sequence CCAACAAAATCATAACTCACAAA TAAAATTAGCTTAAAAATATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 400} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!