ID: 1014416984_1014416987 |
View in Genome Browser |
Spacer: 11 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1014416984 | 1014416987 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 6:121195365-121195387 | 6:121195399-121195421 |
Sequence | CCATCTTCTGCAGATAACCACTC | GACAGCTCTTGGCATGTTACTGG |
Strand | - | + |
Off-target summary | {0: 5, 1: 190, 2: 196, 3: 119, 4: 360} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |