ID: 1014416984_1014416987 |
View in Genome Browser |
Spacer: 11 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1014416984 | 1014416987 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:121195365-121195387 | 6:121195399-121195421 |
| Sequence | CCATCTTCTGCAGATAACCACTC | GACAGCTCTTGGCATGTTACTGG |
| Strand | - | + |
| Off-target summary | {0: 5, 1: 190, 2: 196, 3: 119, 4: 360} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||