ID: 1014421054_1014421056 |
View in Genome Browser |
Spacer: -6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1014421054 | 1014421056 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:121245786-121245808 | 6:121245803-121245825 |
| Sequence | CCCTACTTGAAACATCAACATTC | ACATTCCCACAGATGAAAAGAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 2, 1: 10, 2: 34, 3: 87, 4: 324} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||