ID: 1014471705_1014471711

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1014471705 1014471711
Species Human (GRCh38) Human (GRCh38)
Location 6:121823351-121823373 6:121823395-121823417
Sequence CCCAGCAGCTAAGAAAACAACTC AAAGCCAGTGTCAGGTACCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 233} {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!