ID: 1014486005_1014486008 |
View in Genome Browser |
Spacer: -9 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1014486005 | 1014486008 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:121999966-121999988 | 6:121999980-122000002 |
| Sequence | CCCATTTGTGGTTTTAGTGGGCA | TAGTGGGCAGTGTGGCAGCTTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 127} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||