ID: 1014519433_1014519437

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1014519433 1014519437
Species Human (GRCh38) Human (GRCh38)
Location 6:122422776-122422798 6:122422818-122422840
Sequence CCTGTCATTCAGAGTGGAGAGCA TCCCTAAGTTCAGGCAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 67, 4: 779} {0: 2, 1: 0, 2: 0, 3: 16, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!