ID: 1014523981_1014523989

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1014523981 1014523989
Species Human (GRCh38) Human (GRCh38)
Location 6:122479044-122479066 6:122479089-122479111
Sequence CCACCCTGCTTCTGCTTGCCCTT TCAGTCCCGATGAGATGAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 147, 3: 387, 4: 534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!