ID: 1014526203_1014526209

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1014526203 1014526209
Species Human (GRCh38) Human (GRCh38)
Location 6:122504843-122504865 6:122504869-122504891
Sequence CCTGTTGTGGGCCAGCCTCAACA TCCGTAGGGTATCCGAAGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 103} {0: 1, 1: 1, 2: 7, 3: 14, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!