ID: 1014539681_1014539686

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1014539681 1014539686
Species Human (GRCh38) Human (GRCh38)
Location 6:122660167-122660189 6:122660198-122660220
Sequence CCCCCACCAATTAAGGTGGGTTT CATATGCACTTCCACTATTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 2, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!