ID: 1014545706_1014545711

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1014545706 1014545711
Species Human (GRCh38) Human (GRCh38)
Location 6:122733063-122733085 6:122733097-122733119
Sequence CCCTGGGGTTCTTCTTACTTGGG TGCACAGCCTCCGAAGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 141} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!