ID: 1014569921_1014569930

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1014569921 1014569930
Species Human (GRCh38) Human (GRCh38)
Location 6:122996419-122996441 6:122996450-122996472
Sequence CCAGGCGTTCGCGTCCTCCTCCC CTCCCGAAGGCGAAAATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 135} {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!