ID: 1014569922_1014569930

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1014569922 1014569930
Species Human (GRCh38) Human (GRCh38)
Location 6:122996433-122996455 6:122996450-122996472
Sequence CCTCCTCCCCACCTTCTCTCCCG CTCCCGAAGGCGAAAATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 21, 3: 202, 4: 2004} {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!