ID: 1014569923_1014569930

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1014569923 1014569930
Species Human (GRCh38) Human (GRCh38)
Location 6:122996436-122996458 6:122996450-122996472
Sequence CCTCCCCACCTTCTCTCCCGAAG CTCCCGAAGGCGAAAATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 69, 4: 491} {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!