ID: 1014593715_1014593720

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1014593715 1014593720
Species Human (GRCh38) Human (GRCh38)
Location 6:123306245-123306267 6:123306284-123306306
Sequence CCCATTTGTTACTTAAATGTGGC CCCAAACATTTCCCCAGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 177} {0: 1, 1: 0, 2: 2, 3: 15, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!