ID: 1014601921_1014601926

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1014601921 1014601926
Species Human (GRCh38) Human (GRCh38)
Location 6:123423881-123423903 6:123423910-123423932
Sequence CCTTTTTACTTAAAGACTATGGA TCTGGCCTAACTTGGGTCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!