ID: 1014613117_1014613120

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1014613117 1014613120
Species Human (GRCh38) Human (GRCh38)
Location 6:123568561-123568583 6:123568591-123568613
Sequence CCTCTTTAACTCTTGCACTCTGC CAGGCTTAACATCACATGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 73, 4: 311} {0: 1, 1: 3, 2: 6, 3: 26, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!