ID: 1014673698_1014673706

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1014673698 1014673706
Species Human (GRCh38) Human (GRCh38)
Location 6:124338997-124339019 6:124339044-124339066
Sequence CCACAGATCATTACAAACTTGGT GGACCCAGTGGCTCACGGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!