ID: 1014674718_1014674732

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1014674718 1014674732
Species Human (GRCh38) Human (GRCh38)
Location 6:124349317-124349339 6:124349364-124349386
Sequence CCGAGGCTCCACCCCATTCTCCC TCCAGGGACCCCTTTTTACTTGG
Strand - +
Off-target summary {0: 1, 1: 22, 2: 43, 3: 127, 4: 777} {0: 4, 1: 14, 2: 26, 3: 70, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!