ID: 1014674723_1014674730 |
View in Genome Browser |
Spacer: -5 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1014674723 | 1014674730 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 6:124349330-124349352 | 6:124349348-124349370 |
Sequence | CCATTCTCCCAGTGCACAGGCCG | GGCCGGTTGGGTATTCTCCAGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 12, 2: 32, 3: 85, 4: 260} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |