ID: 1014747889_1014747891

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1014747889 1014747891
Species Human (GRCh38) Human (GRCh38)
Location 6:125221252-125221274 6:125221270-125221292
Sequence CCTCAAATCTTTAGCTGGGTCTG GTCTGTCTGTGGCCACTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 154} {0: 1, 1: 0, 2: 3, 3: 23, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!