|
Left Crispr |
Right Crispr |
| Crispr ID |
1014749520 |
1014749525 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:125239380-125239402
|
6:125239402-125239424
|
| Sequence |
CCACATGGCTGGGAATGCCTCAC |
CAATTATGGCAGAAGGTGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 194, 2: 3582, 3: 7020, 4: 7191} |
{0: 2, 1: 115, 2: 1512, 3: 2779, 4: 5237} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|