ID: 1014818739_1014818748 |
View in Genome Browser |
Spacer: 29 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1014818739 | 1014818748 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:125961869-125961891 | 6:125961921-125961943 |
| Sequence | CCAGATTCTTCTTGGCCTCTCTG | CAGAATCCCTTCAGAAATGAGGG |
| Strand | - | + |
| Off-target summary | {0: 18, 1: 35, 2: 58, 3: 62, 4: 425} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||