ID: 1014848727_1014848739

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1014848727 1014848739
Species Human (GRCh38) Human (GRCh38)
Location 6:126313507-126313529 6:126313558-126313580
Sequence CCCTCTTCCCTCCTCTGACACTG AGATGGTGGTGCAGGAGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 78, 4: 632} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!