ID: 1014865920_1014865923

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1014865920 1014865923
Species Human (GRCh38) Human (GRCh38)
Location 6:126530023-126530045 6:126530037-126530059
Sequence CCACTTCCACTCAAGCAGAGTCC GCAGAGTCCCAGATCATATTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!