ID: 1014913575_1014913588

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1014913575 1014913588
Species Human (GRCh38) Human (GRCh38)
Location 6:127119821-127119843 6:127119859-127119881
Sequence CCTGCGCGGCCGCATCCCCGACA AAAGGGCGCGCGAGGCGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 71} {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!