ID: 1014930037_1014930044

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1014930037 1014930044
Species Human (GRCh38) Human (GRCh38)
Location 6:127324956-127324978 6:127324985-127325007
Sequence CCCTTCCCCCTTGAGTGTAGACT AGTAACTTGCTTCCAAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 187} {0: 1, 1: 1, 2: 1, 3: 23, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!