ID: 1014930042_1014930044

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1014930042 1014930044
Species Human (GRCh38) Human (GRCh38)
Location 6:127324964-127324986 6:127324985-127325007
Sequence CCTTGAGTGTAGACTAAACTTAG AGTAACTTGCTTCCAAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 230} {0: 1, 1: 1, 2: 1, 3: 23, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!