ID: 1015005278_1015005287

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1015005278 1015005287
Species Human (GRCh38) Human (GRCh38)
Location 6:128272831-128272853 6:128272883-128272905
Sequence CCATTTGACCCAGCCATCCCATT CATGCTGCTATAAAGACACACGG
Strand - +
Off-target summary No data {0: 71, 1: 42, 2: 57, 3: 102, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!