|
Left Crispr |
Right Crispr |
Crispr ID |
1015005286 |
1015005287 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:128272867-128272889
|
6:128272883-128272905
|
Sequence |
CCGAAGGATTATTAATCATGCTG |
CATGCTGCTATAAAGACACACGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 6829, 2: 11817, 3: 8267, 4: 5828} |
{0: 71, 1: 42, 2: 57, 3: 102, 4: 274} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|