ID: 1015095309_1015095315

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1015095309 1015095315
Species Human (GRCh38) Human (GRCh38)
Location 6:129408593-129408615 6:129408642-129408664
Sequence CCTTTGCATGATGGAAGAGGTCT CTGGCTGATCACCCTGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 157, 3: 208, 4: 293} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!