ID: 1015095448_1015095453

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1015095448 1015095453
Species Human (GRCh38) Human (GRCh38)
Location 6:129409590-129409612 6:129409629-129409651
Sequence CCCAGTAACAGGCCAAGAGTTGT AGTGATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 17, 1: 184, 2: 186, 3: 148, 4: 230} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!