ID: 1015102803_1015102805

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1015102803 1015102805
Species Human (GRCh38) Human (GRCh38)
Location 6:129501162-129501184 6:129501190-129501212
Sequence CCCAATTCTATTAATAGAAGTAT ACTGAGATCTTAAGCTACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 469} {0: 1, 1: 0, 2: 0, 3: 4, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!