ID: 1015111454_1015111461

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1015111454 1015111461
Species Human (GRCh38) Human (GRCh38)
Location 6:129596449-129596471 6:129596471-129596493
Sequence CCTTCCCAATTCCCCTTGTTCTG GTTGTTTTTATTACTTTTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 65, 4: 956}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!