ID: 1015123374_1015123379

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1015123374 1015123379
Species Human (GRCh38) Human (GRCh38)
Location 6:129725414-129725436 6:129725451-129725473
Sequence CCTGGATTCATCTGTTTATCCTT AGGTTTGTCACCTTTCCGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 412} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!