ID: 1015148577_1015148584

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1015148577 1015148584
Species Human (GRCh38) Human (GRCh38)
Location 6:130015162-130015184 6:130015196-130015218
Sequence CCAGTCTCTTGGACTTCACTCCT ATTTGTGAAGGGCTGGCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 273} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!