ID: 1015219481_1015219486

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1015219481 1015219486
Species Human (GRCh38) Human (GRCh38)
Location 6:130787837-130787859 6:130787868-130787890
Sequence CCCCTGGTTACTCTCACACAATC CTGCATATCAATAAATAGAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!