ID: 1015225186_1015225190

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1015225186 1015225190
Species Human (GRCh38) Human (GRCh38)
Location 6:130849579-130849601 6:130849617-130849639
Sequence CCATTCAACTAATCTCTATAAGA CTGAATAGGAAAATGGACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 268} {0: 1, 1: 7, 2: 18, 3: 83, 4: 586}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!