ID: 1015227059_1015227063

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1015227059 1015227063
Species Human (GRCh38) Human (GRCh38)
Location 6:130869820-130869842 6:130869851-130869873
Sequence CCGGGCGGGGTTCTTCCTCCACC ATACTCCTGTTCCTCCCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 159} {0: 1, 1: 0, 2: 2, 3: 9, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!