ID: 1015264867_1015264872

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1015264867 1015264872
Species Human (GRCh38) Human (GRCh38)
Location 6:131280702-131280724 6:131280726-131280748
Sequence CCCTTAACTGGGGAAGGAGCCCC TAGTTCCTTTTCCCAGTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104} {0: 1, 1: 0, 2: 5, 3: 14, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!