ID: 1015284451_1015284457

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1015284451 1015284457
Species Human (GRCh38) Human (GRCh38)
Location 6:131469352-131469374 6:131469402-131469424
Sequence CCAGGAGCTGAGATCATTTCCTG AAGAAGGAAGGCAAAGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 257} {0: 1, 1: 17, 2: 114, 3: 669, 4: 5033}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!