ID: 1015299419_1015299422

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1015299419 1015299422
Species Human (GRCh38) Human (GRCh38)
Location 6:131635529-131635551 6:131635560-131635582
Sequence CCTTACACAAAGTCCAGAACAAG GCCCACCAAGACTCTTTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 205} {0: 1, 1: 0, 2: 1, 3: 58, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!