ID: 1015304950_1015304956

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1015304950 1015304956
Species Human (GRCh38) Human (GRCh38)
Location 6:131697083-131697105 6:131697106-131697128
Sequence CCAGCAGTAGCTCTAGGGCAAGG AAGGGTAAAGAGAAGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136} {0: 1, 1: 1, 2: 5, 3: 108, 4: 1117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!