ID: 1015360780_1015360786 |
View in Genome Browser |
Spacer: 24 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1015360780 | 1015360786 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:132336686-132336708 | 6:132336733-132336755 |
| Sequence | CCTGTCAGCTAAAGCACATGAGG | GAAAGAGATGAAGAAAAGGAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 3, 2: 48, 3: 641, 4: 4498} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||