ID: 1015366386_1015366394

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1015366386 1015366394
Species Human (GRCh38) Human (GRCh38)
Location 6:132401576-132401598 6:132401595-132401617
Sequence CCCGCCCCGGGCCGCCTGCAGGG AGGGCGCGCCGCGTCCCGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 466} {0: 1, 1: 0, 2: 0, 3: 6, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!