ID: 1015375727_1015375734

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1015375727 1015375734
Species Human (GRCh38) Human (GRCh38)
Location 6:132508180-132508202 6:132508228-132508250
Sequence CCTGTCTCAAAACCATGCAAGCA TAAAGAGTTCCATCAAGTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 922} {0: 1, 1: 0, 2: 0, 3: 13, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!