ID: 1015390715_1015390730

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1015390715 1015390730
Species Human (GRCh38) Human (GRCh38)
Location 6:132678446-132678468 6:132678489-132678511
Sequence CCCAGATGCCTCCCACCAGACCC TACAATTCAACATGAGATTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 171, 4: 1119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!