ID: 1015392770_1015392782

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1015392770 1015392782
Species Human (GRCh38) Human (GRCh38)
Location 6:132701786-132701808 6:132701824-132701846
Sequence CCACTCTCCCCCATCCTCCAGGT AGAGAAAATTTGTGCCCTTGGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 9, 3: 93, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!